98
|
ATCC
gcggatgtggtggaatcggtagacacgcacgcttgaggggcgtgtggctcacgccatgcg agttcaagtctcgccatccgca cyanothece atcc 51142 chrcircular Gcggatgtggtggaatcggtagacacgcacgcttgaggggcgtgtggctcacgccatgcg Agttcaagtctcgccatccgca Cyanothece Atcc 51142 Chrcircular, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Crocosphaera+subtropica+Mare%C5%A1+and+Johansen/pmc07285048__biology___09___00088___s001-7710-18-20 Average 98 stars, based on 1 article reviews
gcggatgtggtggaatcggtagacacgcacgcttgaggggcgtgtggctcacgccatgcg agttcaagtctcgccatccgca cyanothece atcc 51142 chrcircular - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
94
|
ATCC
cyanothece sp strain atcc 51142 Cyanothece Sp Strain Atcc 51142, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Cyanothece+sp/10__1128_slash_jb__01248___13-33-4-7 Average 94 stars, based on 1 article reviews
cyanothece sp strain atcc 51142 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
93
|
ATCC
atcc 51142 pleurocapsa sp Atcc 51142 Pleurocapsa Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Pleurocapsa+sp/pm25222494__41467_2014_BFncomms5937_MOESM1120_ESM-360-40-40 Average 93 stars, based on 1 article reviews
atcc 51142 pleurocapsa sp - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
96
|
ATCC
cyanothece sp atcc 51142 Cyanothece Sp Atcc 51142, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Cyanothece+sp/pmc02821919-121-0-2 Average 96 stars, based on 1 article reviews
cyanothece sp atcc 51142 - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
97
|
ATCC
surface antigen d15 like protein Surface Antigen D15 Like Protein, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Antigen/pmc02878562__supp_M110__112516_jbc__M110__112516___1-248-7-13 Average 97 stars, based on 1 article reviews
surface antigen d15 like protein - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
91
|
ATCC
cyanothece atcc 51142 Cyanothece Atcc 51142, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Pseudomonas+aeruginosa/pmc02246100-121-7-8 Average 91 stars, based on 1 article reviews
cyanothece atcc 51142 - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
94
|
ATCC
pcc 6803 np 442147 72 np 442146 68 synechococcus sp pcc 7335 edx86803 73 edx87870 67 cyanothece sp Pcc 6803 Np 442147 72 Np 442146 68 Synechococcus Sp Pcc 7335 Edx86803 73 Edx87870 67 Cyanothece Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Synechocystis+sp/us10563231-462-111-127 Average 94 stars, based on 1 article reviews
pcc 6803 np 442147 72 np 442146 68 synechococcus sp pcc 7335 edx86803 73 edx87870 67 cyanothece sp - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
95
|
ATCC
51142 acb52753 synechococcus sp 51142 Acb52753 Synechococcus Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Synechococcus+sp/pmc05534331__evx123_SuppFig_S8-1-187-186 Average 95 stars, based on 1 article reviews
51142 acb52753 synechococcus sp - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
94
|
ATCC
cyanobacterial species Cyanobacterial Species, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Synechocystis+sp/10__1146_slash_annurev___biochem___060713___035632-193-19-32 Average 94 stars, based on 1 article reviews
cyanobacterial species - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
99
|
ATCC
51142 chromosome nc 010547 linear a plasmid nc 010539 b plasmid nc 010541 c plasmid nc 010542 d plasmid nc 010543 nostoc sp 51142 Chromosome Nc 010547 Linear A Plasmid Nc 010539 B Plasmid Nc 010541 C Plasmid Nc 010542 D Plasmid Nc 010543 Nostoc Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Plasmid/pm19502815-120-143-142 Average 99 stars, based on 1 article reviews
51142 chromosome nc 010547 linear a plasmid nc 010539 b plasmid nc 010541 c plasmid nc 010542 d plasmid nc 010543 nostoc sp - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
93
|
ATCC
51142 cce 1309 cce 1308 cce 1307 cce 1306 cce 1305 cce 1304 cce 1303 geobacter sp 51142 Cce 1309 Cce 1308 Cce 1307 Cce 1306 Cce 1305 Cce 1304 Cce 1303 Geobacter Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cyanothece+sp+atcc+51142/Geobacter+sp/pmc05175365__supp_gkw843_nar___01925___n___2015___File017-1623-84-83 Average 93 stars, based on 1 article reviews
51142 cce 1309 cce 1308 cce 1307 cce 1306 cce 1305 cce 1304 cce 1303 geobacter sp - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |